About   Help   FAQ
1700008P02Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 1700008P02Rikem1(IMPC)J
Name: RIKEN cDNA 1700008P02 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6382049
Gene: 1700008P02Rik  Location: Chr3:6680478-6685503 bp, - strand  Genetic Position: Chr3, 1.96 cM, cytoband A1
Alliance: 1700008P02Rikem1(IMPC)J page
IMPC: 1700008P02Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGCCACTCTCAGGTTGAT and GGCAAAAGGCTGGGGCTGAC, which resulted in a 348 bp deletion beginning at Chromosome 3 position 6,620,010 bp and ending after 6,620,357 bp (GRCm38/mm10). This mutation deletes 348 bp of ENSMUSE00000569619 (exon 1) and is predicted to cause a change of amino acid sequence after residue 11 for 1 amino acid then return to frame for 47 amino acids before termination. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any 1700008P02Rik Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory