About   Help   FAQ
Pxmp4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pxmp4em1(IMPC)J
Name: peroxisomal membrane protein 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6382543
Gene: Pxmp4  Location: Chr2:154427678-154445592 bp, - strand  Genetic Position: Chr2, 76.79 cM, cytoband H2
Alliance: Pxmp4em1(IMPC)J page
IMPC: Pxmp4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGAATCTCCAGTTCCCATG and GTACATCCGAGAAACCTGCC, which resulted in a 339 bp deletion beginning at Chromosome 2 position 154,592,079 bp and ending after 154,592,417 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000170074 (exon 3) and 140 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pxmp4 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory