About   Help   FAQ
Cstadem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cstadem1(IMPC)J
Name: CSA-conditional, T cell activation-dependent protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6383182
Gene: Cstad  Location: Chr2:30485056-30498957 bp, + strand  Genetic Position: Chr2, 21.71 cM, cytoband B
Alliance: Cstadem1(IMPC)J page
IMPC: Cstad gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTCAGCTGAGCCATAACGG and TCATGAGTTGGTACAGCCAG, which resulted in a 228 bp deletion beginning at Chromosome 2 position 30,608,209 bp and ending after 30,608,436 bp (GRCm38/mm10). This mutation deletes 228 bp from ENSMUSE00000662814 (exon 2) and is predicted to cause a change of amino acid sequence after residue 17 deletes 76 amino acids and remains in frame for the last 11 amino acids before the stop colon. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cstad Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/21/2024
MGI 6.24
The Jackson Laboratory