Pycr3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pycr3^em1(IMPC)J
• Name: pyrroline-5-carboxylate reductase 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6383391
• Gene: Pycr3 Location: Chr15:75788319-75793369 bp, - strand Genetic Position: Chr15, 35.09 cM, cytoband E1
• Alliance: Pycr3^em1(IMPC)J page
• IMPC: Pycr3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTACAGACATTGGTGACCCA and AATTGACTTGATCAGCCCCA, which resulted in a 452 bp deletion beginning at Chromosome 15 position 75,918,943 bp and ending after 75,919,394 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000128499 (exon 2) and 387 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 10 amino acids later. There is a 2 bp insertion (AA) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pycr3 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)