About   Help   FAQ
Slc10a3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc10a3em1(IMPC)J
Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6383678
Gene: Slc10a3  Location: ChrX:73412823-73416955 bp, - strand  Genetic Position: ChrX, 38.0 cM
Alliance: Slc10a3em1(IMPC)J page
IMPC: Slc10a3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCACTCCTTATAGTGCAG and GATGGCTGAATGACATTCAA, which resulted in a 2136 bp deletion beginning at Chromosome X position 74,368,986 bp and ending after 74,371,121 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000655036 (exon 3) and 341 bp of flanking intronic sequence including the splice acceptor, donor and start of translation and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc10a3 Mutation:  3 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/21/2024
MGI 6.24
The Jackson Laboratory