Slc10a3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc10a3^em1(IMPC)J
• Name: solute carrier family 10 (sodium/bile acid cotransporter family), member 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6383678
• Gene: Slc10a3 Location: ChrX:73412823-73416955 bp, - strand Genetic Position: ChrX, 38.0 cM
• Alliance: Slc10a3^em1(IMPC)J page
• IMPC: Slc10a3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCACTCCTTATAGTGCAG and GATGGCTGAATGACATTCAA, which resulted in a 2136 bp deletion beginning at Chromosome X position 74,368,986 bp and ending after 74,371,121 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000655036 (exon 3) and 341 bp of flanking intronic sequence including the splice acceptor, donor and start of translation and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Slc10a3 Mutation: 3 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)