Tbcd^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbcd^em1(IMPC)Bay
• Name: tubulin-specific chaperone d; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6384595
• Synonyms: Tbcd^-
• Gene: Tbcd Location: Chr11:121342817-121507996 bp, + strand Genetic Position: Chr11, 85.41 cM, cytoband E2
• Alliance: Tbcd^em1(IMPC)Bay page
• IMPC: Tbcd gene page

Tbcd^em1(IMPC)Bay/Tbcd^em1(IMPC)Bay mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro hatch from the zona pellucida and form normal outgrowths with apparent inner cell mass and trophectoderm/primitive endoderm cells.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences CTAAGAACTGTGCGATCTATGGG, AGGCTGGTAGTCCAGTTAGCAGG, CATTAGTTAACCTAGCCTGTCGG, AGGCATCATCTGTAAAAACTTGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tbcd Mutation: 66 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)