Isy1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Isy1^em1(IMPC)J
• Name: ISY1 splicing factor homolog; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6384859
• Synonyms: Isy1^-
• Gene: Isy1 Location: Chr6:87795429-87815723 bp, - strand Genetic Position: Chr6, 39.13 cM, cytoband D2
• Alliance: Isy1^em1(IMPC)J page
• IMPC: Isy1 gene page

Isy1^em1(IMPC)J/Isy1^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 that appear as dying morulae but no embryos at E7.5. Embryos fail to hatch from the zona pellucida and to form outgrowths in vitro.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATGAGGCATTCAAAGCCTGG and TGTATTGTGAACAAAAGAGC, which resulted in a 431 bp deletion beginning at Chromosome 6 position 87,825,195 bp and ending after 87,825,625 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000323874 (exon 7) and 313 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Isy1 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)