Lilrb4b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Lilrb4b^em1(IMPC)J
• Name: leukocyte immunoglobulin-like receptor, subfamily B, member 4B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6385151
• Gene: Lilrb4b Location: Chr10:51356757-51362417 bp, + strand Genetic Position: Chr10, 25.5 cM
• Alliance: Lilrb4b^em1(IMPC)J page
• IMPC: Lilrb4b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATCTGTGATTATCTGGTGT and TTTATGACAGCCTCATATGC, which resulted in a 137 bp deletion beginning at Chromosome 10 position 51,481,213 bp and ending after 51,481,349 bp (GRCm38/mm10). This mutation deletes 137 bp from ENSMUSE00001008219 (exon 3) and is predicted to cause a change of amino acid sequence after residue 48 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Lilrb4b Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)