Pwwp2b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pwwp2b^em1(IMPC)J
• Name: PWWP domain containing 2B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6385154
• Gene: Pwwp2b Location: Chr7:138828398-138847172 bp, + strand Genetic Position: Chr7, 84.39 cM
• Alliance: Pwwp2b^em1(IMPC)J page
• IMPC: Pwwp2b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGATGGAGACAGGCCAAAG and TTCTGGGGCCACGTGTTGTG, which resulted in a 1631 bp deletion beginning at Chromosome 7 position 139,254,777 bp and ending after 139,256,407 bp (GRCm38/mm10). This mutation deletes 1631 bp from ENSMUSE00000911429 (exon 2) and is predicted to cause a change of amino acid sequence after residue 44 and early truncation 10 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pwwp2b Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)