Tmem179^em2(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem179^em2(IMPC)J
• Name: transmembrane protein 179; endonuclease-mediated mutation 2, Jackson
• MGI ID: MGI:6385163
• Gene: Tmem179 Location: Chr12:112466618-112477594 bp, - strand Genetic Position: Chr12, 61.2 cM
• Alliance: Tmem179^em2(IMPC)J page
• IMPC: Tmem179 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATACGGTGGGGCCATGCCG and TCAACATCGGAACATTTGCA, which resulted in a 1752 bp deletion beginning at Chromosome 12 position 112,503,097 bp and ending after 112,504,848 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000435049 and ENSMUSE00000435046 (exons 2 and 3) and 1535 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 18 amino acids later. There is a 3 bp insertion (CTA) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tmem179 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)