Insyn2b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Insyn2b^em1(IMPC)J
• Name: inhibitory synaptic factor family member 2B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6385688
• Gene: Insyn2b Location: Chr11:34264822-34372642 bp, + strand Genetic Position: Chr11, 19.72 cM
• Alliance: Insyn2b^em1(IMPC)J page
• IMPC: Insyn2b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCCAGCAAAGTATGAAAGTG and AAGCTCACGCTCTCACTGAA, which resulted in a 1327 bp deletion beginning at Chromosome 11 position 34,401,977 bp and ending after 34,403,303 bp (GRCm38/mm10). This mutation deletes 1327 bp of ENSMUSE00000881654 (exon 2) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 26 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Insyn2b Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)