Cox7a2l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cox7a2l^em1(IMPC)J
• Name: cytochrome c oxidase subunit 7A2 like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6385694
• Gene: Cox7a2l Location: Chr17:83809346-83821762 bp, - strand Genetic Position: Chr17, 53.02 cM
• Alliance: Cox7a2l^em1(IMPC)J page
• IMPC: Cox7a2l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTTTTCAAACTAATCATAG and CGTCCTGTGGACAAAGAGGG, which resulted in a 12,878 bp deletion beginning at Chromosome 17 position 83,501,735 bp and ending after 83,514,612 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000341244, ENSMUSE00000140226, ENSMUSE00001454054 (exons 1,2,3) and 465 bp of flanking intronic sequence including the splice acceptor start site and donor and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cox7a2l Mutation: 60 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)