Znhit2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Znhit2^em1(IMPC)J
• Name: zinc finger, HIT domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6385698
• Synonyms: Znhit2^-
• Gene: Znhit2 Location: Chr19:6111237-6112498 bp, + strand Genetic Position: Chr19, 4.34 cM, cytoband A
• Alliance: Znhit2^em1(IMPC)J page
• IMPC: Znhit2 gene page

Znhit2^em1(IMPC)J/Znhit2^em1(IMPC)J mice exhibit embryonic lethality at implantation, with blastocysts present at E3.5 that cannot expand further or hatch out in vitro.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAATAACCAAAGAAGCGC and GTGGGTCCAAAAGTCTGACG, which resulted in a 1563 bp deletion beginning at Chromosome 19 position 6,061,172 bp and ending after 6,062,734 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000865022 (exon 1) and 282 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	37 assay results
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Znhit2 Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)