About   Help   FAQ
Znhit2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Znhit2em1(IMPC)J
Name: zinc finger, HIT domain containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6385698
Synonyms: Znhit2-
Gene: Znhit2  Location: Chr19:6111237-6112498 bp, + strand  Genetic Position: Chr19, 4.34 cM, cytoband A
Alliance: Znhit2em1(IMPC)J page
IMPC: Znhit2 gene page
Znhit2em1(IMPC)J/Znhit2em1(IMPC)J mice exhibit embryonic lethality at implantation, with blastocysts present at E3.5 that cannot expand further or hatch out in vitro.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAATAACCAAAGAAGCGC and GTGGGTCCAAAAGTCTGACG, which resulted in a 1563 bp deletion beginning at Chromosome 19 position 6,061,172 bp and ending after 6,062,734 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000865022 (exon 1) and 282 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 37 assay results
1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Znhit2 Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory