Ces2c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ces2c^em1(IMPC)J
• Name: carboxylesterase 2C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6385872
• Gene: Ces2c Location: Chr8:105573700-105581115 bp, + strand Genetic Position: Chr8, 53.04 cM
• Alliance: Ces2c^em1(IMPC)J page
• IMPC: Ces2c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTACAGAAAACTAACCCAG and GGAATAACATGGATATACTA, which resulted in a 469 bp deletion beginning at Chromosome 8 position 104,847,963 bp and ending after 104,848,431 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001220643 (exon 2) and 258 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ces2c Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)