Pcdha9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcdha9^em1(IMPC)J
• Name: protocadherin alpha 9; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6385911
• Gene: Pcdha9 Location: Chr18:37130933-37320710 bp, + strand Genetic Position: Chr18, 19.46 cM
• Alliance: Pcdha9^em1(IMPC)J page
• IMPC: Pcdha9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATAGTTCGCTGTTTCTCAG and TTAAAAATACTTGTGCATAG, which resulted in a 2665 bp deletion beginning at Chromosome 18 position 36,997,816 bp and ending after 37,000,480 bp (GRCm38/mm10). This mutation deletes 2665 bp from ENSMUSE00000703749 (exon 1) including the splice acceptor, start site and donor and is predicted to a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pcdha9 Mutation: 45 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)