Ddx46^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ddx46^em1(IMPC)Tcp
• Name: DEAD box helicase 46; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6388358
• Synonyms: Ddx46^-
• Gene: Ddx46 Location: Chr13:55782841-55829069 bp, + strand Genetic Position: Chr13, 30.06 cM, cytoband B2
• Alliance: Ddx46^em1(IMPC)Tcp page
• IMPC: Ddx46 gene page

Ddx46^em1(IMPC)Tcp/Ddx46^em1(IMPC)Tcp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida but form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1438 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CAGGTGCTAATGACCAGGTC targeting the 5' side and ATGCTTGAAACGGTTACAGC targeting the 3' side of a critical region. This resulted in a 694-bp del Chr13:55647250-55647943 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ddx46 Mutation: 46 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)