Traf7^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Traf7^em1(IMPC)Tcp
• Name: TNF receptor-associated factor 7; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6388361
• Synonyms: Traf7^-
• Gene: Traf7 Location: Chr17:24727824-24746912 bp, - strand Genetic Position: Chr17, 12.4 cM
• Alliance: Traf7^em1(IMPC)Tcp page
• IMPC: Traf7 gene page

Traf7^em1(IMPC)Tcp/Traf7^em1(IMPC)Tcp (-/-) embryos show developmental delay. Almost all E10.5 embryos have abnormal head shape and cardiac tissue, some with enlarged hearts and pericardial edema, abnormal branchial arch development, and abnormal blood deposition. Yolk sacs appear pale.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele from project TCPR1504 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGCTATTGAGGTCCTTCGCC targeting the 5' side and CCTCTCTGGGGCTACATTGT targeting the 3' side of a critical region. This resulted in a 646-bp del Chr17: 24513114-24513759 (GRCm38). (J:265051) Inheritance: Not Specified

Strategy for the generation of the Traf7^em1(IMPC)Tcp allele.

Expression

In Mice Carrying this Mutation:	37 assay results
In Structures Affected by this Mutation:	10 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Traf7 Mutation: 44 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)