Efcab3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Efcab3em1(IMPC)J |
Name: |
EF-hand calcium binding domain 3; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6388590 |
Gene: |
Efcab3 Location: Chr11:104954418-105008363 bp, + strand Genetic Position: Chr11, Syntenic
|
Alliance: |
Efcab3em1(IMPC)J page
|
IMPC: |
Efcab3 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGATGCTAAGCTCTCCA and AAAACATCCAGAAGCTTTGG, which resulted in a 269 bp deletion beginning at Chromosome 11 position 104,693,210 bp and ending after 104,693,478 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000353657 (exon 4) and 154 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 63 and early truncation 5 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|