Thoc3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Thoc3^em1(IMPC)J
• Name: THO complex 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6388620
• Synonyms: Thoc3^-
• Gene: Thoc3 Location: Chr13:54606650-54616653 bp, - strand Genetic Position: Chr13, 28.69 cM, cytoband B2
• Alliance: Thoc3^em1(IMPC)J page
• IMPC: Thoc3 gene page

Thoc3^em1(IMPC)J/Thoc3^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as uncompacted morula but not at E7.5. Embryos in vitro hatch from the zona pellucida but form atypical outgrowths with an abnormal inner cell mass and few trophectoderm cells.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAACTTTCCAGATCGCCCA and AATGGGGTGGTAGAGCCCCT, which resulted in a 660 bp deletion beginning at Chromosome 13 position 54,467,578 bp and ending after 54,468,237 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001223112 (exon 2) and 503 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 89 and early truncation 23 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Thoc3 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)