About   Help   FAQ
Fancfem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Fancfem1(IMPC)J
Name: Fanconi anemia, complementation group F; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6388628
Gene: Fancf  Location: Chr7:51510325-51512015 bp, - strand  Genetic Position: Chr7, 32.87 cM
Alliance: Fancfem1(IMPC)J page
IMPC: Fancf gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCCACACTCAAGCACCACC and TTGCTGCACAAGCGGCTCCA, which resulted in a 1010 bp deletion beginning at Chromosome 7 position 51,861,249 bp and ending after 51,862,258 bp (GRCm38/mm10). This mutation deletes 1010 bp of ENSMUSE00000879688 (exon 1) including the start site and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Fancf Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory