Trim35^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trim35^em1(IMPC)J
• Name: tripartite motif-containing 35; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6388663
• Gene: Trim35 Location: Chr14:66534480-66548873 bp, + strand Genetic Position: Chr14, 34.44 cM, cytoband D1
• Alliance: Trim35^em1(IMPC)J page
• IMPC: Trim35 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTTGGGACGCCCCAGCTG and GAGGGTCGATACTCTCCACA, which resulted in a 3327 bp deletion beginning at Chromosome 14 position 66,303,946 bp and ending after 66,307,272 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000123182, ENSMUSE00000123182, ENSMUSE00000123176 (exons 2, 3 and 4) and 2977 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 36 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Trim35 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)