Ssh2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ssh2^em1(IMPC)J
• Name: slingshot protein phosphatase 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6391206
• Gene: Ssh2 Location: Chr11:77107113-77351046 bp, + strand Genetic Position: Chr11, 46.36 cM
• Alliance: Ssh2^em1(IMPC)J page
• IMPC: Ssh2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATGAGATGCTGGCTTAAAG and TTAAAATTCAAGATAAAGTA, which resulted in a 341 bp deletion beginning at Chromosome 11 position 77,408,044 bp and ending after 77,408,384 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001280145 (exon 5) and 219 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 92 and early truncation. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ssh2 Mutation: 61 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)