About   Help   FAQ
Ccdc166em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc166em1(IMPC)J
Name: coiled-coil domain containing 166; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6391231
Gene: Ccdc166  Location: Chr15:75851721-75854134 bp, - strand  Genetic Position: Chr15, 35.18 cM
Alliance: Ccdc166em1(IMPC)J page
IMPC: Ccdc166 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAAGGAGTGCTCTAACGAC and CCATTCTGTTGCTCTGGCAA, which resulted in a 2917 bp deletion beginning at Chromosome 15 position 75,979,638 bp and ending after 75,982,554 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001276403 and ENSMUSE00001220008 (exons 1 and 2) and 459 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc166 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory