Tmem177^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem177^em1(IMPC)J
• Name: transmembrane protein 177; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6392080
• Gene: Tmem177 Location: Chr1:119835620-119840913 bp, - strand Genetic Position: Chr1, 52.53 cM
• Alliance: Tmem177^em1(IMPC)J page
• IMPC: Tmem177 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGAAACTAAGATTTCGACC and AGTCACTCTAGGATGAGTGG, which resulted in a 3508 bp deletion beginning at Chromosome 1 position 119,907,771 bp and ending after 119,911,278 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000391040 (exon 2) and 243 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tmem177 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)