Iqsec2^em1Alev
Endonuclease-mediated Allele Detail

Summary

• Symbol: Iqsec2^em1Alev
• Name: IQ motif and Sec7 domain 2; endonuclease-mediated mutation 1, Andrew P Levy
• MGI ID: MGI:6393275
• Synonyms: A350V IQSEC2
• Gene: Iqsec2 Location: ChrX:150927193-151008232 bp, + strand Genetic Position: ChrX, 68.46 cM
• Alliance: Iqsec2^em1Alev page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Constitutively active, Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Using CRISPR/Cas9 technology with an sgRNA (GGCAGCCCTGCGGCTCAGGA) and an ssODN template (CTGAGCT GCGCAGCCGCTCAAAGTTCTTATTCATACGGTACTGTCGAAAGGCTGTCTGGATGGTCCTGGCAACACGGCGGCTCAGGAAGGAGCCCCCATACTTCCTCTCCAGCATTTCCACCTGTCAGAGGAACAAGTTCAGAAAG), alanine codon 350 (GCT) was changed ta a valine codon (GTT) (p.Ala350Val, C>T nucleotide substitution). Additionally, a silent mutation in arginine codon 349 (AGG>CGT) was created to prevent the sgRNA from targeting the modified allele. This mutation mimics one found in some patients suffering from intellectual disability and epilepsy and renders the enzyme constitutively active. (J:280198)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Iqsec2 Mutation: 12 strains or lines available

References

• Original: J:280198 Rogers EJ, et al., An IQSEC2 Mutation Associated With Intellectual Disability and Autism Results in Decreased Surface AMPA Receptors. Front Mol Neurosci. 2019;12:43
• All: 4 reference(s)