Ldhal6b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ldhal6b^em1(IMPC)J
• Name: lactate dehydrogenase A-like 6B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6393531
• Gene: Ldhal6b Location: Chr17:5467598-5469042 bp, - strand Genetic Position: Chr17, 3.17 cM
• Alliance: Ldhal6b^em1(IMPC)J page
• IMPC: Ldhal6b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAAAGAGCGCAGAGACTATT and TCTCAAGATGCTTGTAGCCC, which resulted in a 1112 bp deletion beginning at Chromosome 17 position 5,417,539 bp and ending after 5,418,650 bp (GRCm38/mm10). This mutation deletes 1112 bp of ENSMUSE00001326799 (exon 1) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ldhal6b Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)