Vstm4^em1Gypk
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vstm4^em1Gypk
• Name: V-set and transmembrane domain containing 4; endonuclease-mediated mutation 1, Gladys Y-P Ko
• MGI ID: MGI:6393534
• Synonyms: PLv^-
• Gene: Vstm4 Location: Chr14:32578713-32661448 bp, + strand Genetic Position: Chr14, 19.4 cM
• Alliance: Vstm4^em1Gypk page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using gRNA sequences (CTAAAGTAAAATAAGACGAAGG andAACGCTGTTGGCATCTCGGAGG) deleted exon 2. (J:285234)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Vstm4 Mutation: 24 strains or lines available

References

• Original: J:285234 Shi L, et al., Newly Identified Peptide, Peptide Lv, Promotes Pathological Angiogenesis. J Am Heart Assoc. 2019 Nov 19;8(22):e013673
• All: 1 reference(s)