Zbed6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zbed6^em1(IMPC)J
• Name: zinc finger, BED type containing 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6393538
• Gene: Zbed6 Location: Chr1:133547678-133589056 bp, - strand Genetic Position: Chr1, Syntenic
• Alliance: Zbed6^em1(IMPC)J page
• IMPC: Zbed6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAGATTGCCAACTACACA and TCTTCTGCCAGGAGAGATTG, which resulted in a 2700 bp deletion beginning at Chromosome 1 position 133,656,861 bp and ending after 133,659,560 bp (GRCm38/mm10). This mutation deletes 2700 bp from ENSMUSE00001073319 (exon 1) and is predicted to cause a change of amino acid sequence after residue 12, deletion of 901 amino acids and a return to frame for the last 67 amino acids and expected termination. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zbed6 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)