Pigz^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pigz^em1(IMPC)J
• Name: phosphatidylinositol glycan anchor biosynthesis, class Z; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6393546
• Gene: Pigz Location: Chr16:31752669-31764864 bp, + strand Genetic Position: Chr16, 22.4 cM
• Alliance: Pigz^em1(IMPC)J page
• IMPC: Pigz gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGGACATCCTGGGTGTGC and TTGGGCTGCTTTGTCACAAC, which resulted in a 1520 bp deletion beginning at Chromosome 16 position 31,944,262 bp and ending after 31,945,781 bp (GRCm38/mm10). This mutation deletes 1520 bp from ENSMUSE00000387814 (exon 3) and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 45 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pigz Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)