Dmtf1l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dmtf1l^em1(IMPC)J
• Name: cyclin D binding myb like transcription factor 1 like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6393702
• Gene: Dmtf1l Location: ChrX:125720085-125723491 bp, - strand Genetic Position: ChrX, 49.81 cM
• Alliance: Dmtf1l^em1(IMPC)J page
• IMPC: Dmtf1l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACTGTGGTCCAGTGGGCA and GAGCTCTGTCTTACTTAGTG, which resulted in a 1381 bp deletion beginning at Chromosome X position 126,814,082 bp and ending after 126,815,466 bp (GRCm38/mm10). This mutation deletes 1381 bp of ENSMUSE00001029817 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and early truncation 7 amino acids later. There is a 4 bp insertion (ACCA) at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dmtf1l Mutation: 3 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)