Arsj^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arsj^em1(IMPC)J
• Name: arylsulfatase J; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6394013
• Gene: Arsj Location: Chr3:126157566-126234025 bp, + strand Genetic Position: Chr3, 55.97 cM
• Alliance: Arsj^em1(IMPC)J page
• IMPC: Arsj gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGAGGTAGACAGTTGGGTT and TGCCACCCAAGTGTTGCCAC, which resulted in a 1357 bp deletion beginning at Chromosome 3 position 126,438,048 bp and ending after 126,439,404 bp (GRCm38/mm10). This mutation deletes 1357 bp of ENSMUSE00000586952 (exon 2) and is predicted to cause a change of amino acid sequence after residue 147 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arsj Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)