Cchcr1^em1Aoka
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cchcr1^em1Aoka
• Name: coiled-coil alpha-helical rod protein 1; endonuclease-mediated mutation 1, Akira Oka
• MGI ID: MGI:6394064
• Synonyms: Alopecic Cchcr1, Cchcr1^p.Arg587Trp
• Gene: Cchcr1 Location: Chr17:35827997-35841912 bp, + strand Genetic Position: Chr17, 18.69 cM
• Alliance: Cchcr1^em1Aoka page

Mutation origin

• Strain of Origin: C57BL/6NJcl

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 591 (CGT) was targeted for change to a tryptophan codon (TGG)(p.R591W) with sgRNAs (targeting GCTGTGTCAGCTCCTGACGGAGG and GGAAGCTGCCAGCCTCCGTCAGG) and an ssODN template (CAGCAGTTGGAGGCAGCACGTCGGGGCCAGCAGGAGAGCACGGAGGAAGCTGCCAGCCTCtGgCAGGAGCTGACACAGCAGCAGGAAATCTACGGGCAAGGTGTGGGGGCGTGGCGGTGTGTG) using CRISPR/CAS9 technology. This mutation mimics the human p.R587W variant associated with susceptibility to alopecia areata. (J:309941)

Disease models

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Cchcr1 Mutation: 41 strains or lines available

References

• Original: J:309941 Oka A, et al., Alopecia areata susceptibility variant in MHC region impacts expressions of genes contributing to hair keratinization and is involved in hair loss. EBioMedicine. 2020 Jul;57:102810
• All: 1 reference(s)