Btbd10^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Btbd10^{em1(IMPC)Hmgu}
• Name: BTB domain containing 10; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6399906
• Gene: Btbd10 Location: Chr7:112914833-112968599 bp, - strand Genetic Position: Chr7, 59.18 cM, cytoband F2
• Alliance: Btbd10^{em1(IMPC)Hmgu} page
• IMPC: Btbd10 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 4 guide sequences CCACTTCAAGGTACTAAGCTTCC, GGCGGGGGCCTCATGAAGACAGG, CCACATTCTATTGTATTAACTTA, TTACTATTTGCTATCGGTACAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Btbd10 Mutation: 33 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)