Smad3^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smad3^em1(IMPC)H
• Name: SMAD family member 3; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6399910
• Gene: Smad3 Location: Chr9:63554049-63665276 bp, - strand Genetic Position: Chr9, 34.22 cM, cytoband D
• Alliance: Smad3^em1(IMPC)H page
• IMPC: Smad3 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 Protein and 2 guide sequences ACTCGGCCGGGATCTCGGTGTGG, CCAGTGGGGGGAACTCGGCCGGG, which resulted in a Indel. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Smad3 Mutation: 22 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)