Zfhx4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfhx4^em1(IMPC)J
• Name: zinc finger homeodomain 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6400544
• Gene: Zfhx4 Location: Chr3:5283586-5480917 bp, + strand Genetic Position: Chr3, 1.96 cM, cytoband A1
• Alliance: Zfhx4^em1(IMPC)J page
• IMPC: Zfhx4 gene page

Mutation origin

• Strain of Origin: Not Specified
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGAGTCACAGGTTTCCA and ACAGCAGCGGCTCTGGCACC, which resulted in a 2576 bp deletion beginning at Chromosome 3 position 5,241,715 bp and ending after 5,244,290 bp (GRCm38/mm10). This mutation deletes 2576 bp of ENSMUSE00000386485 (exon 2) including the start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfhx4 Mutation: 155 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)