Fahd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fahd1^em1(IMPC)J
• Name: fumarylacetoacetate hydrolase domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6401314
• Gene: Fahd1 Location: Chr17:25067866-25069276 bp, - strand Genetic Position: Chr17, 12.53 cM
• Alliance: Fahd1^em1(IMPC)J page
• IMPC: Fahd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGGCTTGTCAGTTCCCTA and TTGGCTGTGAACTCTATGGG, which resulted in a 1932 bp deletion beginning at Chromosome 17 position 24,848,493 bp and ending after 24,850,424 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000343391 (exon 1) and 459 bp of flanking intronic sequence including the splice acceptor, donor and start site. It is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fahd1 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)