Zdhhc22^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zdhhc22^em1(IMPC)J
• Name: zinc finger, DHHC-type containing 22; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6401345
• Gene: Zdhhc22 Location: Chr12:87027537-87037204 bp, - strand Genetic Position: Chr12, 41.17 cM
• Alliance: Zdhhc22^em1(IMPC)J page
• IMPC: Zdhhc22 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTGCTGAACCTGCCTGCCA and AGCATTGTCCAAGGTTCGAA, which resulted in a 607 bp deletion beginning at Chromosome 12 position 86,988,132 bp and ending after 86,988,738 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001414833 (exon 2) and 67 bp of flanking intronic sequence including the splice acceptor, donor and start site. It is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zdhhc22 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)