Tex21^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tex21^em1(IMPC)J
• Name: testis expressed gene 21; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6401351
• Gene: Tex21 Location: Chr12:76245460-76293520 bp, - strand Genetic Position: Chr12, 33.52 cM, cytoband D2
• Alliance: Tex21^em1(IMPC)J page
• IMPC: Tex21 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAAGGAGAGAGTTCGGCGT and TTTGAATGAGAGAAATTCAC, which resulted in a 6247 bp deletion beginning at Chromosome 12 position 76,239,314 bp and ending after 76,245,560 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000369176 and ENSMUSE00000284491 (exons 2 and 3) and 5767 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tex21 Mutation: 101 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)