Tbcc^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbcc^em1(IMPC)J
• Name: tubulin-specific chaperone C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6401486
• Synonyms: Tbcc^-
• Gene: Tbcc Location: Chr17:47201610-47202773 bp, + strand Genetic Position: Chr17, 22.9 cM
• Alliance: Tbcc^em1(IMPC)J page
• IMPC: Tbcc gene page

Tbcc^em1(IMPC)J/Tbcc^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form outgrowths with apparent trophectoderm cells but limited/no inner cell mass.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGGCGAGGAGAATATGGA and ACGCTGTCATACTCAAAGGG, which resulted in a 1313 bp deletion beginning at Chromosome 17 position 46,890,571 bp and ending after 46,891,883 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000323360 (exon 1) and 149 bp of flanking intronic sequence including the splice acceptor, donor and start site is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tbcc Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)