About   Help   FAQ
Zfp513em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp513em1(IMPC)J
Name: zinc finger protein 513; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6402263
Gene: Zfp513  Location: Chr5:31356325-31359647 bp, - strand  Genetic Position: Chr5, 17.27 cM
Alliance: Zfp513em1(IMPC)J page
IMPC: Zfp513 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTCTCAAAGCCCATGAGC and ACTGAAGATTCCTTCGACGA, which resulted in a 108 bp deletion beginning at Chromosome 5 position 31,201,608 bp and ending after 31,201,715 bp (GRCm38/mm10). This mutation deletes 108 bp from ENSMUSE00000972866 (exon 2) and is predicted to cause a loss of 36 amino acids after residue 26 and remain in frame for the expected termination. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp513 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory