Zfp513^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp513^em1(IMPC)J
• Name: zinc finger protein 513; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6402263
• Gene: Zfp513 Location: Chr5:31356325-31359647 bp, - strand Genetic Position: Chr5, 17.27 cM
• Alliance: Zfp513^em1(IMPC)J page
• IMPC: Zfp513 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTCTCTCAAAGCCCATGAGC and ACTGAAGATTCCTTCGACGA, which resulted in a 108 bp deletion beginning at Chromosome 5 position 31,201,608 bp and ending after 31,201,715 bp (GRCm38/mm10). This mutation deletes 108 bp from ENSMUSE00000972866 (exon 2) and is predicted to cause a loss of 36 amino acids after residue 26 and remain in frame for the expected termination. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp513 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)