About   Help   FAQ
Zfp286em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp286em1(IMPC)J
Name: zinc finger protein 286; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6402725
Gene: Zfp286  Location: Chr11:62643403-62680288 bp, - strand  Genetic Position: Chr11, 38.68 cM
Alliance: Zfp286em1(IMPC)J page
IMPC: Zfp286 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTCTTTGATGTCGGATGA and TGACTCCTTGCTCTCAGGTC, which resulted in a 1168 bp deletion beginning at Chromosome 11 position 62,779,722 bp and ending after 62,780,889 bp (GRCm38/mm10). This mutation deletes 1168 bp of ENSMUSE00000355028 (exon 4) and is predicted to cause a change of amino acid sequence after residue 119 and termination 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp286 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory