Prob1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prob1^em1(IMPC)J
• Name: proline rich basic protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6402744
• Gene: Prob1 Location: Chr18:35783400-35788274 bp, - strand Genetic Position: Chr18, 19.2 cM
• Alliance: Prob1^em1(IMPC)J page
• IMPC: Prob1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTTTAAAAAGGTGGCAGC and TTTAAGACGCTTTGACCCCG, which resulted in a 4975 bp deletion beginning at Chromosome 18 position 35,650,319 bp and ending after 35,655,293 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001322141 (exon 1) and 87 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prob1 Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)