Il3ra^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Il3ra^em1(IMPC)J
• Name: interleukin 3 receptor, alpha chain; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6402757
• Gene: Il3ra Location: Chr14:8114270-8123851 bp, - strand Genetic Position: Chr14, 7.08 cM
• Alliance: Il3ra^em1(IMPC)J page
• IMPC: Il3ra gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACCACTCACCCCAAGTAT and GGTGTAAGATTTGGGAGCAG, which resulted in a 423 bp deletion beginning at Chromosome 14 position 14,348,720 bp and ending after 14,349,142 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000565028 (exon 4) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Il3ra Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)