Eid2b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eid2b^em1(IMPC)J
• Name: EP300 interacting inhibitor of differentiation 2B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6402774
• Gene: Eid2b Location: Chr7:27977164-27978914 bp, + strand Genetic Position: Chr7, 16.67 cM
• Alliance: Eid2b^em1(IMPC)J page
• IMPC: Eid2b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGAGCTTCCCGGAGAGAGC and GGCGTTGGGGCCGCGGGCGT, which resulted in a 432 bp deletion beginning at Chromosome 7 position 28,277,795 bp and ending after 28,278,226 bp (GRCm38/mm10). This mutation deletes 432 bp of ENSMUSE00000597783 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Eid2b Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)