Atp6v0b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp6v0b^em1(IMPC)J
• Name: ATPase, H+ transporting, lysosomal V0 subunit B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6402781
• Gene: Atp6v0b Location: Chr4:117741523-117744530 bp, - strand Genetic Position: Chr4, 53.73 cM
• Alliance: Atp6v0b^em1(IMPC)J page
• IMPC: Atp6v0b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTTTGGGTCTAGTGCACAG and GAGTAAACTGGGAGTCCGGT, which resulted in a 3425 bp deletion beginning at Chromosome 4 position 117,884,089 bp and ending after 117,887,513 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000761417-ENSMUSE00000737163 (exons 1-8) and 2425 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Atp6v0b Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)