Usp49^em1Gpt
Endonuclease-mediated Allele Detail

Summary

• Symbol: Usp49^em1Gpt
• Name: ubiquitin specific peptidase 49; endonuclease-mediated mutation 1, GemPharmatech Co., Ltd
• MGI ID: MGI:6403288
• Synonyms: Usp49^-, Usp49^em1Cd182, Usp49^em1Nju
• Gene: Usp49 Location: Chr17:47941615-47997663 bp, + strand Genetic Position: Chr17, 23.72 cM
• Alliance: Usp49^em1Gpt page

Mutation origin

• Strain of Origin: C57BL/6NGpt

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Exon 3 was targeted using two gRNAs (AGACCACATGACTCGGAAGAGGG and AGCCACGGAAGGCGGGAATCAGG) and CRISPR/Cas9 technology, resulting in a 182 bp deletion. This causes a frameshift and premature stop codon. (J:285681)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Usp49 Mutation: 52 strains or lines available

References

• Original: J:285681 Ye L, et al., USP49 negatively regulates cellular antiviral responses via deconjugating K63-linked ubiquitination of MITA. PLoS Pathog. 2019 Apr;15(4):e1007680
• All: 1 reference(s)