Mir338^em1Zchn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mir338^em1Zchn
• Name: microRNA 338; endonuclease-mediated mutation 1, Zhi Chen
• MGI ID: MGI:6403348
• Gene: Mir338 Location: Chr11:119905591-119905688 bp, - strand Genetic Position: Chr11, 83.96 cM
• Alliance: Mir338^em1Zchn page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting using gRNA target sites GGGTCCATGCCTATGGGTG (mm10 chr11:120014710-120014731) and GGGGCTGGCCCTGTAGTGGG (mm10 chr11:120014963-120014985) deleted the microRNA cluster. (J:285968)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mir338 Mutation: 1 strain or line available

References

• Original: J:285968 Lin C, et al., Circulating miR-338 Cluster activities on osteoblast differentiation: Potential Diagnostic and Therapeutic Targets for Postmenopausal Osteoporosis. Theranostics. 2019;9(13):3780-3797
• All: 2 reference(s)