Zfyve19^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfyve19^em1(IMPC)J
• Name: zinc finger, FYVE domain containing 19; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6403734
• Gene: Zfyve19 Location: Chr2:119039098-119047530 bp, + strand Genetic Position: Chr2, 59.97 cM, cytoband E5
• Alliance: Zfyve19^em1(IMPC)J page
• IMPC: Zfyve19 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGGAAGAGTGGTATCCCTA and CTGATACCCACCCTTTTGGG, which resulted in a 1739 bp deletion beginning at Chromosome 2 position 119,210,339 bp and ending after 119,212,077 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001306003, ENSMUSE00001248239, ENSMUSE00001215428, ENSMUSE00001213383, ENSMUSE00001275938 (exons 2 through 6) and 1192 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 61 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfyve19 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)