About   Help   FAQ
Brcc3dcem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Brcc3dcem1(IMPC)J
Name: BRCA1/BRCA2-containing complex, subunit 3, domain containing; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6403852
Gene: Brcc3dc  Location: Chr10:108534905-108536021 bp, - strand  Genetic Position: Chr10, 56.63 cM
Alliance: Brcc3dcem1(IMPC)J page
IMPC: Brcc3dc gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAAGACAGCTCTTCCATA and GATGGCGGTGCGGATGATGC, which resulted in a 846 bp deletion beginning at Chromosome 10 position 108,699,232 bp and ending after 108,700,077 bp (GRCm38/mm10). This mutation deletes 846 bp from ENSMUSE00001410224 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 remove 282 amino acids, return to frame for the last 4 amino acids before the stop. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Brcc3dc Mutation:  6 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/02/2024
MGI 6.13
The Jackson Laboratory