Brcc3dc^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Brcc3dc^em1(IMPC)J
• Name: BRCA1/BRCA2-containing complex, subunit 3, domain containing; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6403852
• Gene: Brcc3dc Location: Chr10:108534905-108536021 bp, - strand Genetic Position: Chr10, 56.63 cM
• Alliance: Brcc3dc^em1(IMPC)J page
• IMPC: Brcc3dc gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAAGACAGCTCTTCCATA and GATGGCGGTGCGGATGATGC, which resulted in a 846 bp deletion beginning at Chromosome 10 position 108,699,232 bp and ending after 108,700,077 bp (GRCm38/mm10). This mutation deletes 846 bp from ENSMUSE00001410224 (exon 1) and is predicted to cause a change of amino acid sequence after residue 5 remove 282 amino acids, return to frame for the last 4 amino acids before the stop. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Brcc3dc Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)