Pop5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pop5^em1(IMPC)J
• Name: processing of precursor 5, ribonuclease P/MRP family (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6403854
• Synonyms: Pop5^-
• Gene: Pop5 Location: Chr5:115373505-115379031 bp, + strand Genetic Position: Chr5, 56.01 cM
• Alliance: Pop5^em1(IMPC)J page
• IMPC: Pop5 gene page

Pop5^em1(IMPC)J/Pop5^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as uncompacted morula. Mutants fail to hatch from the zona pellucida and are dead after 72 hr in vitro, never forming blastocysts.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGATTTCGACAGTTTTGTGG and GCGTTTTGTACGATAGTGGA, which resulted in a 611 bp deletion beginning at Chromosome 5 position 115,237,751 bp and ending after 115,238,361 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000519136, ENSMUSE00000465080 (exons 2 and 3) and 222 bp of flanking intronic sequence including the splice acceptor, donor and start site and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pop5 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)